The University of Leicester has today launched a new Richard III website with further information on the research. There is currently an incomplete page of multimedia resources but it looks as though there will be some very interesting videos added to this page in the days and weeks to come, and we can probably expect to see a video of the full press conference for those who missed it.
Genealogy research was crucial to the investigation. The researchers were able to trace two direct matriline descendants of Anne of York, Richard III's sister, both of whom provided DNA samples for mitochondrial DNA testing. One of the descendants chose to remain anonymous. The second descendant is a Canadian by the name of Michael Ibsen who is now living in London. The genealogical research was greatly facilitated by earlier research by the historian John Ashdown-Hill, and the line that he established has now been independently verified. An outline of the matriline can be seen here. Professor Kevin Schürer, the University of Leicester's Pro-Vice-Chancellor for Research and Enterprise, discusses the process in this YouTube video:
The full details of the DNA testing have not yet been revealed, so we do not yet have confirmation of the haplogroup and we do not know how much of Richard III's mtDNA could be sequenced. However, Michael Ibsen's mother, the late Joy Ibsen, had her mtDNA tested several years ago and we know that she belongs to haplogroup J, one of the rarer mtDNA haplogroups. Assuming that these earlier results were accurate we can, therefore, infer that Richard III is also haplogroup J. The University of Leicester website includes a stunning electropherogram showing the matching mitochondrial DNA results of Richard III, Michael Ibsen and the anonymous donor. There is already a large haplogroup J project at Family Tree DNA and, once the DNA results are known, it will be interesting to see if anyone in the project matches the Richard III DNA signature. Ideally for genealogical matching purposes we require a sequence of the full mitochondrial genome (all 16,569 base pairs). However, because of the rarity of haplogroup J and all the overwhelming evidence from other sources, a partial match would be sufficient in this particular case. Michael Ibsen and his sister do not have any children and their mtDNA line will, therefore, become extinct upon their death, demonstrating once again how important it is to obtain DNA records while you still have the chance.
The researchers are also hoping to extract some Y-chromosome DNA but this research is still in the early stages, and it will probably be some time before we know if this is possible.
Channel 4 has been following the dig and the subsequent research for the last five months and a programme will be shown tonight at 9.00 pm (UK) called Richard III: King in the Car Park. A preview can be seen here:
I wonder if the exciting discovery of the remains of Richard III will now open the doors for a scientific investigation of the remains of the two skeletons discovered under the stairs in the Tower of London in 1674 which are thought to be the bodies of the Princes in the Tower. The bones were reburied in Westminster Abbey but the Queen and the church authorities have refused previous requests to exhume the bodies.
Update
See this thread on the Genealogy DNA mailing list and a further follow-up thread for a discussion of the mtDNA results.
Update 6 February 2013
The Richard III press conference can now be seen on YouTube.
Update 8th February 2013
James Lick has used his mtDNA haplogroup prediction program to analyse what is known of Richard III's mtDNA sequence. See his blog post "Analyzing the mtDNA of the presumed Richard III skeleton with mthap" and the follow-up blog post in which he suggests that the inferred haplogroup is most likely J1c2c. The J1c2c haplogroup has been confirmed by Dr Turi King in an article published in Science News.
Useful links
The following links might also be of interest:
- Leicester University's Richard III website
- Richard III: The King in the Car Park (Channel 4 website)
- Press release from the University of Leicester
- Press release from the Richard III Society
- The University of Leicester's Richard III Facebook page
- The Richard III Society
- The University of Leicester's Greyfriars Project website
- Live updates from the This is Leicestershire website
- Facial reconstruction shows how king may have looked
- Richard III: The twisted bones that reveal a king
- BBC 4 Today interview with the historian John Ashdown-Hill
- The Last Days of Richard III and the Fate of his DNA: the Book that Inspired the Dig by John Ashdown-Hill
- Wikipedia article on the exhumation of Richard III
- Now is the winter of our uncertainty made glorious summer by this sun of journalistic zeal by Julian Champkin
19 comments:
Very very exciting! Such a marvelous result for this interdisciplinary research team! Wonderful. Thanks so much for your links to various other sites with their details too.
Haplogroup J represents 10% of mtDNA signatures part of the French Heritage DNA project.
The ancestress Catherine de Rouet originated from the Flanders, which is part of Northern France and of Belgium nowadays.
Jacques, That's interesting. Do you have anyone in your project with A16087C?
Oh, dear -- someone with better eyes or transcribing skills has corrected my rendition. The interesting mutation A16087C is not present in the diagram. Here's the correction, a segment which would be quite common in haplogroup J.
CAACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGCA
Thanks Ann. I'd just seen your post on the list and had changed the links in my post just before your comment came in. That's not quite so exciting. Let's hope they've managed to sequence a bit more than just HVR1.
When I click on any of the links to the matrilineage of Michael Ibsen back to Anne of York, the website says it is unavailable, as it has used up all its storage space for the month.
Please, is there another site we can view? How unfortunate if we will all need to wait until March 1to view it!
This will be of considerable interest to those of us who, although not descended from the Dukes of York, are descendants of Catherine de Roet.
That's odd. The website was fine yesterday. I've found the page in the Internet Archive and I've updated the link to point to that page instead. You will also find details of the tree on the University of Leicester's Richard III website:
http://www.le.ac.uk/richardiii/science/familytree.html
My paternal first cousins and I are 2nd cousins 16x removed from Richard through his grandmother Anne Mortimer and great grandmother Eleanor Holland. We are 18th great grandchildren of Catherine (nee de Rouet) Swynford.
I've been fascinated by King Richard since I read The Last Plantagenets when I was 13, in 1965. Never thought of a familial relation till I discovered it in past year.
From a GPS (Genealogical Proof Standard) evaluation and proof standpoint, I question the accuracy and validity of this statement concerning the "anonymous" distant cousin / mtDNA donor written about by the University Research Team and in a recent "The Legal Genealogist" blog posting:
“So Michael Ibsen and his anonymous distant cousin , the men whose DNA was tested for comparison, can’t pass this type of DNA on to their own children.”
Based on the following quote from Dr. John Ashdown Hill made in a Jan 2013 aeticle, I believe this anonymous mtDNA sample is instead the Canadian mother (now deceased) of Michael Ibsen … Joy Ibsen / Joy M Brown (born 1926 as Muriel Brown and died in 2008 in London, Ontario Canada as a retired journalist) and the team did not have “her” proper informed consent and hence they scrambled to invent and fabricate this anonymous distant cousin scenario … and if they did indeed do this, what else did they fabricate?
If they had access to Joy's sample and did not use it ... they should so state this and the reasons it could not be used. Tell us "all" the details ... not just some selective ones.
John (a history PhD) says he contacted Joy in 2005. Has he had her DNA sampled prior to her death or after her death? He is quoted as saying:
“Eventually I traced one line to Joy Isben in Canada, and I contacted her and SHE gave a DNA sample.”
I very well realize that mtDNA evidence in this 500+ year old case is more corroborative than definitive, and there is other evidence, but I still question who this "anonymous" J1C2C mtDNA donor is and “when” and “where” this DNA sample was provided to the research team. And why wasn't Joy's DNA sample mentioned?
Besides the DNA sample from the skeleton and that from Michael Ibsen they did seek a third sample (and perhaps a fourth one) for mtDNA Triangulation purposes and I believe that one of the DNA samples was indeed from Joy.
Further evidence that Joy has her DNA tested is here:
”They will also be subjected to DNA analysis. The remains will be matched against the DNA of Joy Ibsen, a 16th generation descendant of Anne of York, the sister of Richard III. Mrs Ibsen died four years ago, aged 82. At the site yesterday, Mrs Ibsen’s son Michael, 55, watched as the search began. The furniture-maker, who was born in Canada but now lives in London, said his mother would have been thrilled by the project. ‘The family were entertained when she got the call several years ago from a historian claiming she was a descendant,’ he added.”
Here’s more about the mtDNA leading to Joy Brown and her 3 children:
http://web.archive.org/web/20111225033616/http://plantagenetdna.webs.com/table1.htm
There are "Peer Reviews" and then there are "Public Reviews" / "Public Questions" such as I making herein.
George, I suggest you watch the full press conference where the DNA testing process is explained. It is already known that a sample was extracted from Joy Ibsen as I stated in my blog post. This was done for another research project. The anonymous donor was from a different part of the tree. In light of the media publicity you can quite understand why someone would wish to remain anonymous. I have not seen have any details of the J subclade. Where did you get the reference to J1C2C?
George, I've now discovered the source of the J1c2c and I've added an update to my blog post with the relevant links.
Debbie,
I am not asserting that the University Scientist Team "made up the facts". I am asserting, just as equally wrong as a conspiracy, that they "did not include all of the relevant and important facts" and just "cherry picked the made for the media facts" for their well orchestrated BIG REVEAL press conference on Monday.
Reminds me of the Finding Your Roots Big Reveals staging and dramatic moments. As you maybe aware, many academics are critical of them for not first publishing their material in peer reviewed journals.
Yes, there was another research project initiated much earlier by a PhD part of the University Research Team --- John, a Ricardian.
Remember, they want to open up a Richard III Visitors Center (York now fighting for it also); enhance the University reputation; sell some books; sell some Made in China Richard III trinkets; enhance the reputation of Richard III; do some movie deals etc.
Take a look at the Ricardian lady who brought this deal to the University and her merry cast. The "Back Stories" are just as good as the "Lead Story" here.
And some of those facts are not being heard because of the trove of hoofbeats from unaware and eager reporters & bloggers along with a trove of hoofbeats from naive Genetic Genealogists that do not take the time to fact check and do some critical analysis of their own.
This Team did indeed have a viable J1C2C mtDNA sample from Joy Ibsen (died 2008 in Canada) taken sometime between 2005 and 2008.
But a dead person does not make good press and perhaps they did not have her informed consent. So, this is a 3rd sample we know they had access to (in addition to that from the skeleton of Richard III) ... why didn't they acknowledge this 1st and earliest DNA sample from Joy Ibsen and the guy who made it happen in 2005, John? Is it about some book deal or movie deal? I listened to the Press Conference and they (Turi King) did not mention Joy's DNA Test on Monday.
When you are doing critical forensic type of DNA analysis... do you just willy nilly omit certain results?
No - No - No, you don't and they did. Perhaps an unscrupulous DA or police official might ... but now some academics are doing it! To me, that's over the top.
You asked where I got the info on J1C2C. I cannot divulge the original source but see the James Lick blog piece here: http://blog.jameslick.com/?m=201302 and also this 2010 book written by a key player in all this: The Last Days of Richard III by John Ashdown-Hill.
I have read that book and did considerable back story work on all this including consultative talks with leading PhDs in this area.
Most are eagerly awaiting to critically review any research papers published in Antiquity and elsewhere.
John had Joy's test analyzed by Oxford Ancestors and another Lab for verification.
John also is coming out with a new book and perhaps has a movie deal or documentary deal in the works.
George Jones
According to Wikipedia
http://en.wikipedia.org/wiki/Haplogroup_J_%28mtDNA%29
there are several key subclades of haplogroup J which have varying distributions in Europe. Now, the frequencies are puzzling as how can J* for instance be 12% of the people of Ireland if it is rare; maybe I don't understand them. But is there any clue which subclade Ms. Gibsen is?
This is important; there are several theories of Richard III's maternal lineage, and for instance if J was as Eastern a clade as I is, that would support Catherine Valois in the maternal line because that line leads to a Polish princess. Other viable theories lead to northern France/ Flanders.
Dora
Villandra, I added some updates at the bottom of my blog post with details of the subclade. Turi King has confirmed that Richard III is J1c2c. Ann Turner and James Lick also deduced that he was J1c2c from the DNA evidence that has been published to date.
George, You need to wait until all the details have been published. There is no cover-up. No one is denying that DNA has been extracted from Joy Ibsen. Only a limited amount of information can be given in a brief press conference so of course they have to focus on the key findings. It seems eminently sensible to me to take a further sample from Joy Ibsen's son as an additional check against the sample provided by Joy herself. I would only have been surprised if they hadn't done so. I presume that the researchers would have done a full mitochondrial sequence test on Michael Ibsen whereas only a partial profile was obtained in the previous testing done by Oxford Ancestors and a second European organisation. John Ashdown-Hill's research has been acknowledged by the University of Leicester and he appeared in the Channel 4 documentary on Monday. As you will see from the update to my blog there is now confirmation of the J1c2c haplogroup. I think Leicester University have every right to make the most that they can from this historic finding. Such was the intense international interest in the dig that they were obliged to reveal some of the results in advance of publication to keep the press at bay. This editorial in Nature sums it up very nicely:
http://www.nature.com/news/body-of-evidence-1.12362
J1C2C has been said to have a distribution frequency between 1% and 2% by Turi King (no documentation) and now Nick Wade of the New York Times says today its 1% (was no documentation). A mere 50% reduction!
Chris Tyler-Smith said the mitochondrial DNA type identified by Dr. King was “rare enough to be interesting, but not rare enough to be conclusive.” Gee ... is that academic speak for ... I am clueless and really don't know? I mean, has the scientist delved into mtDNA in NW France where some of this may lead?
I guess the new modern way (as is the sentiment of Debbie, University of Leicester, New York Times, etc) vetting scientific research by Press Conference and News Stories is the coming thing.
Perhaps some new Interactive Youtube Channel will replace all those burdensome "Pay for an Article" Journal sites for scientific research. Pitty the naive Genetic Genealogist (and their bloggers) who believe in this new modern way.
Here's the NYT piece and looks like some possible news on Y-DNA. Any guesses to which Y-DNA Hg?
February 11, 2013
Tracing a Royal Y Chromosome
By NICHOLAS WADE New York Times
Researchers last week developed DNA evidence to help identify the remains of a skeleton found under a parking lot in Leicester, England, as those of Richard III, the last English king to die in battle, in 1485. But the researchers’ work is only half-done. They have made a strong but not conclusive link through the female line, and are now turning to the male side for corroboration.
Turi King, a geneticist at the University of Leicester, found a match in the mitochondrial DNA extracted from the parking lot skeleton and that of two living descendants of Anne of York, Richard III’s sister. About 1 percent of the English population carries this type. Mitochondrial DNA is bequeathed exclusively through the female line.
Chris Tyler-Smith, a geneticist at the Wellcome Trust Sanger Institute near Cambridge, said the mitochondrial DNA type identified by Dr. King was “rare enough to be interesting, but not rare enough to be conclusive.”
The Leicester team plans to investigate the paternal DNA of the remains. Kevin Schürer, a historian at the university, has already found four living descendants of John of Gaunt, the son of Edward III, who was Richard III’s great-great-grandfather. Dr. King has found that their Y chromosome, which is carried only by men, match, establishing that they are all true descendants of John of Gaunt.
The Y chromosome DNA from the skeleton is very degraded, but Dr. King said she had found that she could amplify it and hopes to get enough to make a match with the living descendants.
George, No one is advocating the publication of scientific results by blog, newspaper and YouTube. There has been unprecedented interest in this case and it is only natural that people want as much detail as possible. Newspapers have a habit of distorting the facts which is why publication in scientific journals is so important. I would like to see a reliable source for the distribution of J1C2C. I don't imagine there are enough sequences available to give a good esimate.
I see no need to speculate on the Y-DNA haplogroup of John of Gaunt. I'd rather wait until we receive information from a reliable source or the results are published in a peer-reviewed journal.
Debbie,
Do we agree on these Points:?
Point 1: "Irrespective of other evidence and facts, Human DNA evidence and analysis for identification purposes and lineage purposes is at best CORROBORATIVE versus DEFINITIVE". And that goes for mtDNA, Y-DNA, Autosomal DNA, etc.
Point 2: "Written Genealogical Records going back 500 years (25 Generations) are often in error, misinterpreted, impossible to find, lost because of poor care, fire, flood, etc."?
Point 3: "For the Genealogical Community, the best way for research to be presented for public consumption is via "quality" peered review journals who also have a capable Editor & Editorial Board"
Now it seems to me that in your last comment you opined about"waiting" on that for King Richard III Y-DNA results... but yet you seem to favor Dr. Turi King and the University and their haste with the mtDNA and accompanying Press Conference.
Is there some gender thing going on here in favoring mtDNA?
From the latest commentary I have read about Dr. Turi King, the University Administrators (for their PR purposes) short circuited the peer journal route and from what I have read, the King ain't liking all this.
I hope King can depart this Richard III gig and edit the JOGG soon before CeCe ( a 23andMe Ambassador & proclaimed Mensa member) thinks she can fill that position.
George
I agree with your Point 1.
I disagree with Point 2. As far as English records are concerned there are very good records for royal and noble families which can be used to compile solid pedigrees going back for 500 years or more. American records are a different matter.
Point 3 is more difficult because there is no peer-reviewed journal in the UK where genealogical information can be published. I would imagine the Richard III pedigree will be published in a history journal.
mtDNA is more likely to survive in ancient DNA because there are hundreds of mitochondria in every cell so it's only natural that mtDNA was tested first. We have Turi King on record regarding Richard III's haplogroup. You're speculating about the Y-DNA haplogroup when the details have not yet been released.
The peer review process has not been short-circuited. Papers will follow. The media interest had to be satisfied. It's already taken much longer than scheduled to get this far. This is an unprecedented situation. The University of Leicester and the people of Leicester are quite entitled to enjoy their spot in the limelight.
Post a Comment